Sequence Decoding

Next

ninja icon

Skill:

•  Deducing the DNA base sequence for the mRNA strand

    
mRNA → DNA

mRNA is a complementary copy of a DNA segment (gene) and consequently can be used to deduce the gene sequence

For converting a sequence from mRNA to the original DNA code, apply the rules of complementary base pairing:

  • Cytosine (C) is replaced with Guanine (G) – and vice versa
  • Uracil (U) is replaced by Adenine (A)
  • Adenine (A) is replaced by Thymine (T)


Example:   (mRNA)  AUG  CCA  GUG  ACU  UCA  GGG  ACG  AAU  GAC  UUA

Answer:        (DNA)   TAC  GGT  CAC  TGA  AGT  CCC  TGC  TTA  CTG  AAT


ninja icon

Skill:

•  Use a table of mRNA codons and their corresponding amino acids to deduce the sequence of amino acids

   coded by a short mRNA strand of known base sequence

    
mRNA → Polypeptide

In order to translate an mRNA sequence into a polypeptide chain, it is important to establish the correct reading frame

The mRNA transcript is organised into triplets of bases called codons, and as such three different reading frames exists

  • An open reading frame starts with AUG and will continue in triplets to a termination codon
  • A blocked reading frame may be frequently interrupted by termination codons


Once the start codon (AUG) has been located and reading frame established, the corresponding amino acid sequence can be deduced using the genetic code 

Example:   (mRNA)  GUAUGCACGUGACUUUCCUCAUGAGCUGAU

Answer:    (codons)  GU  AUG  CAC  GUG  ACU  UUC  CUC  AUG  AGC  UGA  U

Answer:   (amino acid)     Met    His     Val     Thr    Phe    Leu    Met    Ser   STOP


The Genetic Code (Grid)

genetic code (grid)